Plasmid Preparation:Article Title: Genetically engineered human induced pluripotent stem cells for the production of brain-targeting extracellular vesicles.
Article Snippet: HRP-linked secondary antibodies, including anti-rabbit IgG and anti-mouse IgG, are purchased from the Cell Signaling Technology. .. pAAVS1-P-CAG-DEST donor plasmid, containing 5’ and 3’ AAVS1 homologous arms (HAs) for recombination into the AAVS1 site was obtained from Addgene (ID: 80490[16]). .. RVG-Lamp2B-HA [9] sequence (1407 bp) was gene synthesized by Genscript and then cloned into pAAVS1-P-CAG-DEST plasmid at KpnI and BstXI sites in order to obtain pAAVS1-RVG-Lamp2B-HA donor plasmid. pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid was obtained from Addgene (ID: 42230[17]). pX330AAVS1 T2 plasmid with gRNA sequence G G G G C C A C T A G G G A C A G G A T for human AAVS1 locus was obtained from Addgene (ID: 72833[18]).
Article Title: Genetically engineered human induced pluripotent stem cells for the production of brain-targeting extracellular vesicles
Article Snippet: HRP-linked secondary antibodies, including anti-rabbit IgG and anti-mouse IgG, are purchased from the Cell Signaling Technology. .. pAAVS1-P-CAG-DEST donor plasmid, containing 5’ and 3’ AAVS1 homologous arms (HAs) for recombination into the AAVS1 site was obtained from Addgene (ID: 80490[ ]). .. RVG-Lamp2B-HA [ ] sequence (1407 bp) was gene synthesized by Genscript and then cloned into pAAVS1-P-CAG-DEST plasmid at KpnI and BstXI sites in order to obtain pAAVS1-RVG-Lamp2B-HA donor plasmid. pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid was obtained from Addgene (ID: 42230[ ]). pX330-AAVS1 T2 plasmid with gRNA sequence GGGGCCACTAGGGACAGGAT for human AAVS1 locus was obtained from Addgene (ID: 72833[ ]).
Article Title: Transcription Factor-Mediated Generation of Dopaminergic Neurons from Human iPSCs—A Comparison of Methods
Article Snippet: .. To stably integrate the hALAN cassette into the AAVS1 site and generate iPSCs expressing hALAN for iDA differentiation, a workflow outlined in –D was followed. iPSCs were transfected with 500 ng of the hALAN plasmid, 3 pmol of 2 sgRNAs against AAVS1 ( for sgRNA sequences), 3 pmol of Alt-R HiFi Cas9 enzyme, and 100 ng of pCE-mp53DD (dominant-negative p53; addgene plasmid # 41856) using Lipofectamine Stem following the manufacturer’s protocol. ..
Article Title: Gene correction of Wiskott-Aldrich-syndrome iPS cells rescues proplatelet defects and improves platelet size.
Article Snippet: .. AAVS1 gene targeting design For targeting WASP expression cassette at the AAVS1 site, hAAVS1L TALEN (Addgene plasmid # 35431) and hAAVS1R TALEN (Addgene plasmid # 35432), gifts from Feng Zhang, were used to introduce DNA DSB at the target region. .. For donor vector construction, the MNDWASP and the WAS1.6-WASP were amplified from pRRL-MND-WASp (Addgene plasmid # 36248) and pRRL-WS1.6-WASp (Addgene plasmid # 36250)(gifts from David Rawlings), respectively and cloned into the AAV-CAGGS-EGFP (a gift from Rudolf Jaenisch, Addgene plasmid # 22212) after removal of the CAGGS-EGFP.
Article Title: Transcription factor-mediated generation of dopaminergic neurons from human iPSCs – a comparison of methods
Article Snippet: .. To stably integrate the hALAN cassette into the AAVS1 site and generate iPSCs expressing hALAN for iDA differentiation, a workflow outlined in Fig. S2A-D was followed. iPSCs were transfected with 500 ng of the plasmid, 3 pmol of 2 sgRNAs against AAVS1 (Table S1 for sgRNA sequences), 3 pmol of Alt-R HiFi Cas9 enzyme and 100 ng of pCE-mp53DD (dominant-negative p53; addgene plasmid # 41856) using Lipofectamine Stem following the manufacturer’s protocol. ..
Article Title: Gene correction of Wiskott-Aldrich-syndrome iPS cells rescues proplatelet defects and improves platelet size.
Article Snippet: .. AAVS1 gene targeting design For targeting WASP expression cassette at the AAVS1 site, hAAVS1L TALEN (Addgene plasmid # 35431) and hAAVS1R TALEN (Addgene plasmid # 35432), gifts from Feng Zhang, were used to introduce DNA DSB at the target region21. .. For donor vector construction, the MNDWASP and the WAS1.6-WASP were amplified from pRRL-MND-WASp (Addgene plasmid # 36248) and pRRL-WS1.6-WASp (Addgene plasmid # 36250)39(gifts from David Rawlings), respectively and cloned into the AAV-CAGGS-EGFP (a gift from Rudolf Jaenisch40, Addgene plasmid # 22212) after removal of the CAGGS-EGFP.
Stable Transfection:Article Title: Transcription Factor-Mediated Generation of Dopaminergic Neurons from Human iPSCs—A Comparison of Methods
Article Snippet: .. To stably integrate the hALAN cassette into the AAVS1 site and generate iPSCs expressing hALAN for iDA differentiation, a workflow outlined in –D was followed. iPSCs were transfected with 500 ng of the hALAN plasmid, 3 pmol of 2 sgRNAs against AAVS1 ( for sgRNA sequences), 3 pmol of Alt-R HiFi Cas9 enzyme, and 100 ng of pCE-mp53DD (dominant-negative p53; addgene plasmid # 41856) using Lipofectamine Stem following the manufacturer’s protocol. ..
Article Title: Transcription factor-mediated generation of dopaminergic neurons from human iPSCs – a comparison of methods
Article Snippet: .. To stably integrate the hALAN cassette into the AAVS1 site and generate iPSCs expressing hALAN for iDA differentiation, a workflow outlined in Fig. S2A-D was followed. iPSCs were transfected with 500 ng of the plasmid, 3 pmol of 2 sgRNAs against AAVS1 (Table S1 for sgRNA sequences), 3 pmol of Alt-R HiFi Cas9 enzyme and 100 ng of pCE-mp53DD (dominant-negative p53; addgene plasmid # 41856) using Lipofectamine Stem following the manufacturer’s protocol. ..
Expressing:Article Title: Transcription Factor-Mediated Generation of Dopaminergic Neurons from Human iPSCs—A Comparison of Methods
Article Snippet: .. To stably integrate the hALAN cassette into the AAVS1 site and generate iPSCs expressing hALAN for iDA differentiation, a workflow outlined in –D was followed. iPSCs were transfected with 500 ng of the hALAN plasmid, 3 pmol of 2 sgRNAs against AAVS1 ( for sgRNA sequences), 3 pmol of Alt-R HiFi Cas9 enzyme, and 100 ng of pCE-mp53DD (dominant-negative p53; addgene plasmid # 41856) using Lipofectamine Stem following the manufacturer’s protocol. ..
Article Title: Gene correction of Wiskott-Aldrich-syndrome iPS cells rescues proplatelet defects and improves platelet size.
Article Snippet: .. AAVS1 gene targeting design For targeting WASP expression cassette at the AAVS1 site, hAAVS1L TALEN (Addgene plasmid # 35431) and hAAVS1R TALEN (Addgene plasmid # 35432), gifts from Feng Zhang, were used to introduce DNA DSB at the target region. .. For donor vector construction, the MNDWASP and the WAS1.6-WASP were amplified from pRRL-MND-WASp (Addgene plasmid # 36248) and pRRL-WS1.6-WASp (Addgene plasmid # 36250)(gifts from David Rawlings), respectively and cloned into the AAV-CAGGS-EGFP (a gift from Rudolf Jaenisch, Addgene plasmid # 22212) after removal of the CAGGS-EGFP.
Article Title: Transcription factor-mediated generation of dopaminergic neurons from human iPSCs – a comparison of methods
Article Snippet: .. To stably integrate the hALAN cassette into the AAVS1 site and generate iPSCs expressing hALAN for iDA differentiation, a workflow outlined in Fig. S2A-D was followed. iPSCs were transfected with 500 ng of the plasmid, 3 pmol of 2 sgRNAs against AAVS1 (Table S1 for sgRNA sequences), 3 pmol of Alt-R HiFi Cas9 enzyme and 100 ng of pCE-mp53DD (dominant-negative p53; addgene plasmid # 41856) using Lipofectamine Stem following the manufacturer’s protocol. ..
Article Title: Gene correction of Wiskott-Aldrich-syndrome iPS cells rescues proplatelet defects and improves platelet size.
Article Snippet: .. AAVS1 gene targeting design For targeting WASP expression cassette at the AAVS1 site, hAAVS1L TALEN (Addgene plasmid # 35431) and hAAVS1R TALEN (Addgene plasmid # 35432), gifts from Feng Zhang, were used to introduce DNA DSB at the target region21. .. For donor vector construction, the MNDWASP and the WAS1.6-WASP were amplified from pRRL-MND-WASp (Addgene plasmid # 36248) and pRRL-WS1.6-WASp (Addgene plasmid # 36250)39(gifts from David Rawlings), respectively and cloned into the AAV-CAGGS-EGFP (a gift from Rudolf Jaenisch40, Addgene plasmid # 22212) after removal of the CAGGS-EGFP.
Transfection:Article Title: Transcription Factor-Mediated Generation of Dopaminergic Neurons from Human iPSCs—A Comparison of Methods
Article Snippet: .. To stably integrate the hALAN cassette into the AAVS1 site and generate iPSCs expressing hALAN for iDA differentiation, a workflow outlined in –D was followed. iPSCs were transfected with 500 ng of the hALAN plasmid, 3 pmol of 2 sgRNAs against AAVS1 ( for sgRNA sequences), 3 pmol of Alt-R HiFi Cas9 enzyme, and 100 ng of pCE-mp53DD (dominant-negative p53; addgene plasmid # 41856) using Lipofectamine Stem following the manufacturer’s protocol. ..
Article Title: Transcription factor-mediated generation of dopaminergic neurons from human iPSCs – a comparison of methods
Article Snippet: .. To stably integrate the hALAN cassette into the AAVS1 site and generate iPSCs expressing hALAN for iDA differentiation, a workflow outlined in Fig. S2A-D was followed. iPSCs were transfected with 500 ng of the plasmid, 3 pmol of 2 sgRNAs against AAVS1 (Table S1 for sgRNA sequences), 3 pmol of Alt-R HiFi Cas9 enzyme and 100 ng of pCE-mp53DD (dominant-negative p53; addgene plasmid # 41856) using Lipofectamine Stem following the manufacturer’s protocol. ..
Dominant Negative Mutation:Article Title: Transcription Factor-Mediated Generation of Dopaminergic Neurons from Human iPSCs—A Comparison of Methods
Article Snippet: .. To stably integrate the hALAN cassette into the AAVS1 site and generate iPSCs expressing hALAN for iDA differentiation, a workflow outlined in –D was followed. iPSCs were transfected with 500 ng of the hALAN plasmid, 3 pmol of 2 sgRNAs against AAVS1 ( for sgRNA sequences), 3 pmol of Alt-R HiFi Cas9 enzyme, and 100 ng of pCE-mp53DD (dominant-negative p53; addgene plasmid # 41856) using Lipofectamine Stem following the manufacturer’s protocol. ..
Article Title: Transcription factor-mediated generation of dopaminergic neurons from human iPSCs – a comparison of methods
Article Snippet: .. To stably integrate the hALAN cassette into the AAVS1 site and generate iPSCs expressing hALAN for iDA differentiation, a workflow outlined in Fig. S2A-D was followed. iPSCs were transfected with 500 ng of the plasmid, 3 pmol of 2 sgRNAs against AAVS1 (Table S1 for sgRNA sequences), 3 pmol of Alt-R HiFi Cas9 enzyme and 100 ng of pCE-mp53DD (dominant-negative p53; addgene plasmid # 41856) using Lipofectamine Stem following the manufacturer’s protocol. ..
Introduce:Article Title: Gene correction of Wiskott-Aldrich-syndrome iPS cells rescues proplatelet defects and improves platelet size.
Article Snippet: .. AAVS1 gene targeting design For targeting WASP expression cassette at the AAVS1 site, hAAVS1L TALEN (Addgene plasmid # 35431) and hAAVS1R TALEN (Addgene plasmid # 35432), gifts from Feng Zhang, were used to introduce DNA DSB at the target region. .. For donor vector construction, the MNDWASP and the WAS1.6-WASP were amplified from pRRL-MND-WASp (Addgene plasmid # 36248) and pRRL-WS1.6-WASp (Addgene plasmid # 36250)(gifts from David Rawlings), respectively and cloned into the AAV-CAGGS-EGFP (a gift from Rudolf Jaenisch, Addgene plasmid # 22212) after removal of the CAGGS-EGFP.
Article Title: Gene correction of Wiskott-Aldrich-syndrome iPS cells rescues proplatelet defects and improves platelet size.
Article Snippet: .. AAVS1 gene targeting design For targeting WASP expression cassette at the AAVS1 site, hAAVS1L TALEN (Addgene plasmid # 35431) and hAAVS1R TALEN (Addgene plasmid # 35432), gifts from Feng Zhang, were used to introduce DNA DSB at the target region21. .. For donor vector construction, the MNDWASP and the WAS1.6-WASP were amplified from pRRL-MND-WASp (Addgene plasmid # 36248) and pRRL-WS1.6-WASp (Addgene plasmid # 36250)39(gifts from David Rawlings), respectively and cloned into the AAV-CAGGS-EGFP (a gift from Rudolf Jaenisch40, Addgene plasmid # 22212) after removal of the CAGGS-EGFP.
|
Addgene inc is a verified supplier 